|
ATCC
human panc1 male cells ![]() Human Panc1 Male Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human panc1 male cells/product/ATCC Average 99 stars, based on 1 article reviews
human panc1 male cells - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp vps35 mm00458167 m1 ![]() Gene Exp Vps35 Mm00458167 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp vps35 mm00458167 m1/product/Thermo Fisher Average 93 stars, based on 1 article reviews
gene exp vps35 mm00458167 m1 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
MathWorks Inc
real-time computer xpc target 5.1 ![]() Real Time Computer Xpc Target 5.1, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/real-time computer xpc target 5.1/product/MathWorks Inc Average 90 stars, based on 1 article reviews
real-time computer xpc target 5.1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab's real-time xpc platform ![]() Matlab's Real Time Xpc Platform, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab's real-time xpc platform/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab's real-time xpc platform - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
real-time windows target ![]() Real Time Windows Target, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/real-time windows target/product/MathWorks Inc Average 90 stars, based on 1 article reviews
real-time windows target - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rabbit anti mtor ![]() Rabbit Anti Mtor, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti mtor/product/Cell Signaling Technology Inc Average 99 stars, based on 1 article reviews
rabbit anti mtor - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
hrp conjugated and goat anti rabbit igg ![]() Hrp Conjugated And Goat Anti Rabbit Igg, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hrp conjugated and goat anti rabbit igg/product/Cell Signaling Technology Inc Average 99 stars, based on 1 article reviews
hrp conjugated and goat anti rabbit igg - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
histone h3 ![]() Histone H3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/histone h3/product/Cell Signaling Technology Inc Average 99 stars, based on 1 article reviews
histone h3 - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
MathWorks Inc
xpc target real-time system ![]() Xpc Target Real Time System, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/xpc target real-time system/product/MathWorks Inc Average 90 stars, based on 1 article reviews
xpc target real-time system - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
xpc target real time data capture computer ![]() Xpc Target Real Time Data Capture Computer, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/xpc target real time data capture computer/product/MathWorks Inc Average 96 stars, based on 1 article reviews
xpc target real time data capture computer - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
paper n a sirna targeting hsp90a b santa cruz sc35608 morpholino mo p53 gcgccattgctttgcaagaattg ![]() Paper N A Sirna Targeting Hsp90a B Santa Cruz Sc35608 Morpholino Mo P53 Gcgccattgctttgcaagaattg, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paper n a sirna targeting hsp90a b santa cruz sc35608 morpholino mo p53 gcgccattgctttgcaagaattg/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
paper n a sirna targeting hsp90a b santa cruz sc35608 morpholino mo p53 gcgccattgctttgcaagaattg - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
DSMZ
human yapc male cells ![]() Human Yapc Male Cells, supplied by DSMZ, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human yapc male cells/product/DSMZ Average 92 stars, based on 1 article reviews
human yapc male cells - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell reports
Article Title: Reprogramming of nucleotide metabolism by interferon confers dependence on the replication stress response pathway in pancreatic cancer cells
doi: 10.1016/j.celrep.2021.110236
Figure Lengend Snippet: (A) Principal-component analysis (PCA) of fold changes in 485 metabolites measured by LC-MS in SUIT2, YAPC, and PANC1 cells treated ±100 U/mL IFNβ for 24 h (n = 6). Numbers and percentages of metabolites significantly altered by IFNβ treatment are indicated (FDR ≤ 10%). (B) Metabolite set enrichment analysis (MSEA) of significantly altered metabolites in each cell line. (C) Summary of IFN-induced alterations in nucleotide and NAD+/NADH metabolism in SUIT2 cells. (D) Relative levels of indicated metabolites in PDAC cell lines treated ±100 U/mL IFNβ for 24 h (mean ± SD, n = 6, unpaired t test). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.
Article Snippet:
Techniques: Liquid Chromatography with Mass Spectroscopy
Journal: Cell reports
Article Title: Reprogramming of nucleotide metabolism by interferon confers dependence on the replication stress response pathway in pancreatic cancer cells
doi: 10.1016/j.celrep.2021.110236
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet:
Techniques: Virus, Microarray, Recombinant, Lysis, Protease Inhibitor, Membrane, Saline, Autoradiography, Plasmid Preparation, Control, BIA-KA, Reverse Transcription, Enzyme-linked Immunosorbent Assay, Expressing, Software, Mass Spectrometry, Targeted Proteomics, Real-time Polymerase Chain Reaction, Live Cell Imaging
Journal: Cell reports
Article Title: Mast cell regranulation requires a metabolic switch involving mTORC1 and a glucose-6-phosphate transporter
doi: 10.1016/j.celrep.2022.111346
Figure Lengend Snippet: Key resources table
Article Snippet:
Techniques: Avidin-Biotin Assay, Recombinant, Electron Microscopy, Protease Inhibitor, Coomassie Assay, Labeling, cDNA Synthesis, SYBR Green Assay, Microarray, Negative Control, Plasmid Preparation, Software, Spectrophotometry, Hybridization, Real-time Polymerase Chain Reaction
Journal: Cell reports
Article Title: Mast cell regranulation requires a metabolic switch involving mTORC1 and a glucose-6-phosphate transporter
doi: 10.1016/j.celrep.2022.111346
Figure Lengend Snippet: Key resources table
Article Snippet:
Techniques: Avidin-Biotin Assay, Recombinant, Electron Microscopy, Protease Inhibitor, Coomassie Assay, Labeling, cDNA Synthesis, SYBR Green Assay, Microarray, Negative Control, Plasmid Preparation, Software, Spectrophotometry, Hybridization, Real-time Polymerase Chain Reaction
Journal: Molecular cell
Article Title: Maintaining iron homeostasis is the key role of lysosomal acidity for cell proliferation
doi: 10.1016/j.molcel.2020.01.003
Figure Lengend Snippet: Key Resources Table
Article Snippet:
Techniques: Virus, Cell Viability Assay, Bicinchoninic Acid Protein Assay, Sample Prep, Flow Cytometry, Recombinant, Magnetic Beads, Labeling, SYBR Green Assay, CRISPR, Software, Targeted Proteomics, Control, Microscopy, Real-time Polymerase Chain Reaction, Imaging
Journal: eLife
Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response
doi: 10.7554/eLife.60637
Figure Lengend Snippet: ( A ) The level of trapped PARP1 in HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. *** p < 0.001. ( B ) Staining of cytosolic dsDNA in HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Left, representative image of PicoGreen (green) staining. DAPI (blue) was used to visualize the nucleus. Scale bars represent 10 μm. Right, the graph shows the quantification of the number of cells with cytosolic dsDNA. Values were presented as means ± SEM from three biological replicates (n = 3 fields,≥100 cells counted per condition). Significance was determined with unpaired Student’s t-test. **** p < 0.0001. ( C ) The extent of DNA damage in HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. ** p < 0.01. ( D ) The level of pS172 TBK1 in HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. ** p < 0.01. ( E ) The level of pS396 IRF3 in HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Left, representative image of pS396 IRF3 levels (green). DAPI (blue) was used to visualize the nucleus. Scale bars represent 20 μm. Right, the graph shows the quantification of the number of cells stained positive for pS396 IRF3 in nucleus. Values were presented as means ± SEM from three biological replicates (n = 3 fields,≥100 cells counted per condition). Significance was determined with unpaired Student’s t-test. *** p < 0.001. ( F ) RT-qPCR of type I interferons levels in HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Values of Inf-α and Inf-β were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. * p < 0.05, ** p < 0.01. ( G ) Knock-down of cGAS. HeLa cells expressing the control shRNA (shScramble) or shcGAS (shcGAS #1 or #2) were probed using the indicated antibodies. Right, the graph shows the ratio of cGAS depletion. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. *** p < 0.001. ( H ) Depletion of cGAS abolishes PARPi-induced activation of innate immune signaling. HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) were treated with or without Talazoparib (10 µM for 72 hr). The cells were lysed and were immunoblotted using the indicated antibodies. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. **** p < 0.0001, n.s., not significant. ( I ) RT-qPCR analyses of type I interferons. HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) were treated with or without Talazoparib (10 µM for 72 hr). Values of Inf-α and Inf-β mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. **** p < 0.0001, n.s., not significant.
Article Snippet:
Techniques: Isolation, Control, Staining, Quantitative RT-PCR, Knockdown, Expressing, shRNA, Activation Assay
Journal: eLife
Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response
doi: 10.7554/eLife.60637
Figure Lengend Snippet: ( A ) RT-qPCR analyses of cGAS-STING target gene expression in HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Values of cytokines and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( B ) The levels of trapped PARP1 in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 µM for 72 hr). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the levels of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. *** p < 0.001, n.s., not significant. ( C ) The extent of DNA damage in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. *** p < 0.001, n.s., not significant. ( D ) RT-qPCR analyses of cGAS-STING target gene expression in HeLa cells expressing shRNA against control (shScramble) or cGAS (shcGAS #1 or #2) that were treated with or without Talazoparib (10 µM for 72 hr). Values of cytokines and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with two-way ANOVA. *** p < 0.001, **** p < 0.0001, n.s., not significant.
Article Snippet:
Techniques: Quantitative RT-PCR, Targeted Gene Expression, Expressing, shRNA, Control, Isolation
Journal: eLife
Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response
doi: 10.7554/eLife.60637
Figure Lengend Snippet: ( E ) The levels of trapped PARP1 in MHH-ES-1 cells treated with or without Talazoparib (1 µM for 24 hr). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. ** p < 0.01. ( F ) The extent of DNA damage in MHH-ES-1 cells treated with or without Talazoparib (1 µM for 24 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. ** p < 0.01. ( G ) The level of pS172 TBK1 in MHH-ES-1 cells treated with or without Talazoparib (1 µM for 24 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with unpaired Student’s t-test. ** p < 0.01. ( H ) Reproducibility of the TMT experiments. The signal-to-noise (SN) values of the corresponding TMT channels for each protein was extracted from the two biological replicate experiments. ( I ) Quantification of protein expression in MHH-ES-1 cells treated with Talazoparib 1 µM for 24 hr . Top, the graph shows the log 2 value of total protein expression in Talazoparib-treated vs. DMSO control. Bottom, the heatmap shows quantification reproducibility of the up- and down-regulated protein. Red: up-regulated proteins; Green: down-regulated proteins. ( J ) GO analysis of the up-regulated proteins as shown in ( I ). The list shows the top 10 enriched biological processes of the up-regulated proteins. ( K ) RT-qPCR analyses of the cGAS-STING target gene expression in MHH-ES-1 cells treated with or without Talazoparib (1 µM for 24 hr). Values of type I interferons, cytokines, and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with unpaired Student’s t-test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Article Snippet:
Techniques: Isolation, Control, Expressing, Quantitative RT-PCR, Targeted Gene Expression
Journal: eLife
Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response
doi: 10.7554/eLife.60637
Figure Lengend Snippet: ( A ) PARPi-induced PARP1 trapping in wild-type (WT) and PARP1 knockout (KO) HeLa cells. Cell were also treated with or without Talazoparib (10 µM for 72 hr). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. **** p < 0.001, n.s., not significant. ( B ) DDR in WT and PARP1 KO HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. *** p < 0.001, n.s., not significant. ( C ) The level of pS172 TBK1 in WT and PARP1 KO HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. **** p < 0.0001, n.s., not significant. ( D ) Staining of pS396 IRF3 levels in WT and PARP1 KO HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Left, a representative image of pS396 IRF3 levels (green). DAPI (blue) was used to visualize the nucleus. Right, the graph shows the quantification of the number of cells stained positive for pS396 IRF3 in the nucleus. Values were presented as means ± SEM from three biological replicates. Significance was determined with two-way ANOVA. **** p < 0.0001, n.s., not significant. ( E ) RT-qPCR analyses of type I interferons in WT and PARP1 KO HeLa cells treated with or without Talazoparib (10 µM for 72 hr). Values of Inf-α and Inf-β mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with two-way ANOVA. * p < 0.05, ** p < 0.01, n.s., not significant.
Article Snippet:
Techniques: Knock-Out, Isolation, Control, Staining, Quantitative RT-PCR
Journal: eLife
Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response
doi: 10.7554/eLife.60637
Figure Lengend Snippet: ( A ) The level of trapped PARP1 in HeLa cells treated with or without the indicated PARPi (10 µM for 72 hr). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. * p < 0.05, *** p < 0.001. ( B ) The extent of DNA damage in HeLa cells treated with or without the indicated PARPi (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. ** p < 0.01, *** p < 0.001. ( C ) The level of pS172 TBK1 in HeLa cells treated with or without the indicated PARPi (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. * p < 0.05, *** p < 0.001. ( D ) Heatmap of PARP1 trapping, DNA damage, and pS172 TBK1 levels for each PARPi. The normalized levels of PARP1 trapping ( A ), γH2AX ( B ), and pS172 TBK1 ( C ) are shown. ( E ) PARPi does not induce the trapping of a PARP1 mutant with defective DNA binding. Top, HeLa PARP1 KO cells expressing WT PARP1 or R138C mutant PARP1 (R138C) were treated with or without Talazoparib (10 µM for 72 hr). Chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the levels of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ** p < 0.01, *** p < 0.001. ( F ) The extent of DNA damage in HeLa PARP1 KO cells expressing WT PARP1 or R138C PARP1 that were treated with or without Talazoparib (10 µM for 72 hr). Left, whole cell lysates were probed using the indicated antibodies. Right, the graph shows the quantification of γH2AX and pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with two-way ANOVA. ** p < 0.01, *** p < 0.001. ( G ) RT-qPCR analyses of type I interferons in HeLa PARP1 KO cells expressing WT or R138C PARP1 that were treated with or without Talazoparib (10 µM for 72 hr). Values of Inf-α and Inf-β mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with two-way ANOVA. ** p < 0.01, *** p < 0.001.
Article Snippet:
Techniques: Isolation, Control, Mutagenesis, Binding Assay, Expressing, Quantitative RT-PCR
Journal: eLife
Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response
doi: 10.7554/eLife.60637
Figure Lengend Snippet: ( A ) The level of PARP1 in HeLa cells treated with either Rucaparib or iRucaparib-AP6 (10 µM for 72 hr). Whole cell lysates were probed using the indicated antibodies. GAPDH was used as the loading control. ( B ) The level of trapped PARP1 in HeLa cells treated with either Rucaparib or iRucaparib-AP6 (10 µM for 72 hr). Top, chromatin-bound fractions were isolated and were probed using the indicated antibodies. Histone H3 was used as the loading control. Bottom, the graph shows the quantification of the level of PARP1 trapping. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. *** p < 0.001. ( C ) The extent of DNA damage in HeLa cells treated with either Rucaparib or iRucaparib-AP6 (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of γH2AX levels. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. *** p < 0.001. ( D ) The level of pS172 TBK1 in HeLa cells treated with either Rucaparib or iRucaparib-AP6 (10 µM for 72 hr). Top, whole cell lysates were probed using the indicated antibodies. Bottom, the graph shows the quantification of pS172 TBK1 levels. Values were presented as means ± SD from three biological replicates. Significance was determined with one-way ANOVA. ** p < 0.01. ( E ) RT-qPCR analyses of the cGAS-STING target gene expression in HeLa cells treated with either Rucaparib or iRucaparib-AP6 (10 µM for 72 hr). Values of type I interferons, cytokines, and ISGs mRNA levels were presented as means ± SEM from three biological replicates. Significance was determined with one-way ANOVA. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( F ) The model of the activation of innate immune response via PARPi-induced PARP1 trapping.
Article Snippet:
Techniques: Control, Isolation, Quantitative RT-PCR, Targeted Gene Expression, Activation Assay
Journal: eLife
Article Title: PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response
doi: 10.7554/eLife.60637
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Modification, Mutagenesis, Fractionation, Cell Culture, Labeling, Cell Viability Assay, Software, Reverse Transcription, Real-time Polymerase Chain Reaction, SYBR Green Assay, Extraction, Mass Spectrometry
Journal: Cell reports
Article Title: Reprogramming of nucleotide metabolism by interferon confers dependence on the replication stress response pathway in pancreatic cancer cells
doi: 10.1016/j.celrep.2021.110236
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet:
Techniques: Virus, Microarray, Recombinant, Lysis, Protease Inhibitor, Membrane, Saline, Autoradiography, Plasmid Preparation, Control, BIA-KA, Reverse Transcription, Enzyme-linked Immunosorbent Assay, Expressing, Software, Mass Spectrometry, Targeted Proteomics, Real-time Polymerase Chain Reaction, Live Cell Imaging